
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000077221
- Ensembl ID:
- ENSDARG00000077221
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30720 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa10492 | Essential Splice Site | Available for shipment | Available now |
sa10424 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa30720
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113791 | Nonsense | 243 | 409 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 47414264)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 47347833 GRCz11 20 47251554 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGGATTTTTAATCCCTACTTTGCTTAGCCTCAAGACAAAGCTATTTGAA[A/T]AGATGCCCCATTTGCTTTATAATTCATACATTGTTACCACTATCTGTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10492
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113791 | Essential Splice Site | 322 | 409 | 2 | 4 |
ENSDART00000113791 | Essential Splice Site | 322 | 409 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 47414013)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 47348084 GRCz11 20 47251805 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTRCAAAGTCTAGATACAGTGAGAGATGACAACGCTRTGAAATCTGATAA[G/C]TCAGAGAAAAWWTTTTTTGTCTGTCATAATGCCAAATCACYATCTGACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10424
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113791 | Essential Splice Site | 322 | 409 | 2 | 4 |
ENSDART00000113791 | Essential Splice Site | 322 | 409 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 47414013)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 47348084 GRCz11 20 47251805 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTRCAAAGTCTAGATACAGTGAGAGATGACAACGCTRTGAAATCTGATAA[G/C]TCAGAGAAAAWWTTTTTTGTCTGTCATAATGCCAAATCACYATCTGACAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: