zgc:153116

Ensembl ID:
ENSDARG00000077205
ZFIN ID:
ZDB-GENE-060825-107
Description:
hypothetical protein LOC751712 [Source:RefSeq peptide;Acc:NP_001038888]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8814 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098206 Nonsense 233 321 3 3
ENSDART00000145065 Nonsense 208 291 2 2
Genomic Location (Zv9):
Chromosome 4 (position 60415709)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74892986
GRCz11 4 76474049
KASP Assay ID:
2259-5220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCAGTGCAGGAGGAGCTTTGCCATGGAAGCGGCATTCGACAAGCAC[A/T]AGAAAATCCACGCTGGAGAAAAACCTTTRGTTTGCAAACAGTGTGGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link