si:dkey-26i13.10

Ensembl ID:
ENSDARG00000077198
ZFIN ID:
ZDB-GENE-090312-144
Human Orthologue:
CHST12
Human Description:
carbohydrate (chondroitin 4) sulfotransferase 12 [Source:HGNC Symbol;Acc:17423]
Mouse Orthologue:
Chst12
Mouse Description:
carbohydrate sulfotransferase 12 Gene [Source:MGI Symbol;Acc:MGI:1929064]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115316 Nonsense 344 402 1 1
ENSDART00000140329 Nonsense 333 391 1 1
Genomic Location (Zv9):
Chromosome 1 (position 10918539)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11050616
GRCz11 1 11737416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTTGGGAAACTAGAAACTCTTCATGAGGACACAGAACATTTGCTG[A/T]AGATTCTTGGACTCAGTAATCAGATTCGTTTCCCCCCAGGGTACCGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link