slc15a1a

Ensembl ID:
ENSDARG00000077192
ZFIN ID:
ZDB-GENE-091204-9
Human Orthologue:
SLC15A1
Human Description:
solute carrier family 15 (oligopeptide transporter), member 1 [Source:HGNC Symbol;Acc:10920]
Mouse Orthologue:
Slc15a1
Mouse Description:
solute carrier family 15 (oligopeptide transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:186137

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090215 Nonsense 714 717 23 23
ENSDART00000133112 Nonsense 731 734 23 23
Genomic Location (Zv9):
Chromosome 9 (position 1035338)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1002829
GRCz11 9 1160461
KASP Assay ID:
554-1749.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGAGACWCTAGAAATGGAGGAAAAGGAGAACGAGCAGRAAATCAAA[C/T]AAACCAAGATTTAAGACTTGAAGATTGAGTTRCGCTCATGCTAATATCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link