zgc:152977

Ensembl ID:
ENSDARG00000077178
ZFIN ID:
ZDB-GENE-060825-353
Description:
hypothetical protein LOC751759 [Source:RefSeq peptide;Acc:NP_001038933]
Human Orthologue:
SUN1
Human Description:
Sad1 and UNC84 domain containing 1 [Source:HGNC Symbol;Acc:18587]
Mouse Orthologue:
Sun1
Mouse Description:
Sad1 and UNC84 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13376 Nonsense Available for shipment Available now
sa16097 Nonsense Available for shipment Available now
sa22046 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106163 Nonsense 40 574 3 16
ENSDART00000124562   None 723 None 17
ENSDART00000139254   None 315 None 7
Genomic Location (Zv9):
Chromosome 12 (position 11585120)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10468191
GRCz11 12 10506034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATTTCTTTCTCATTCACTGACAGGACTCTGAAGAGCAGAAGATCTTG[T/A]CATTCTGTTTTAGAGTCAGCACCAAATTTTCAAACGCCGAGGTTTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106163   None 574 None 16
ENSDART00000124562 Nonsense 536 723 13 17
ENSDART00000139254 Nonsense 251 315 6 7
Genomic Location (Zv9):
Chromosome 12 (position 11566519)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10449590
GRCz11 12 10487433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTCAGATKTATRCAATTCTGWTTTTNTTTTGTGTCCYTACAGCATGTA[C/T]AGCTGATTGTCACCAATGCAATRAAGCTCTACTCTGAAGACCGCATTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106163   None 574 None 16
ENSDART00000124562 Nonsense 656 723 15 17
ENSDART00000139254   None 315 None 7
Genomic Location (Zv9):
Chromosome 12 (position 11561740)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10444811
GRCz11 12 10482654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCGCCCACTGGAAACATCAGCAGTGCCCCACGAGAATTCAATGTATA[T/A]GTGAGTACCAAACCATGGGAGCTCAAACCATGTTTCCCCATCTTTTGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link