zgc:174888

Ensembl ID:
ENSDARG00000077176
ZFIN ID:
ZDB-GENE-030328-33
Description:
hypothetical protein LOC558116 [Source:RefSeq peptide;Acc:NP_001107056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42683 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113764 Nonsense 41 226 2 5
ENSDART00000143983 Nonsense 30 31 2 2

The following transcripts of ENSDARG00000077176 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 15607263)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13965722
GRCz11 16 13855842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGACGATCAGAAATCTGCAGGACTCCGTAAACATTGAAAGAACGAGC[G/T]GATTCGTGAGTTTCGCATTTTTAATAATGCCTATTTGCTTGCTGGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link