
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-46g23.2
- Ensembl ID:
- ENSDARG00000077171
- ZFIN ID:
- ZDB-GENE-070705-476
- Human Orthologue:
- A2ML1
- Human Description:
- alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33077 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33076 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33075 | Nonsense | Available for shipment | Available now |
sa19929 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33077
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047865 | Nonsense | 11 | 1458 | 1 | 34 |
ENSDART00000108732 | Nonsense | 11 | 401 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 3931456)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 3616006 GRCz11 3 3398259 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTGGATGATTGCTCATCATGGCGATGATGGAGATCAGTGTTTGGAAGTG[G/A]ATCAATCTAGTCCTTTTCTTCTGTTTTGTTGATGGTGCCATGCTTGCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33076
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047865 | Nonsense | 893 | 1458 | 20 | 34 |
ENSDART00000108732 | None | 401 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 3925146)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 3609696 GRCz11 3 3391949 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTAGGAACTGTAAACGTGACCATTAGTGCTGAGGCCAGTCCATCCCAG[G/T]AATTGTGTGGCGATCAGGATGTGACTGTACCATCAAGAGGACGCATTGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33075
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047865 | Nonsense | 931 | 1458 | 21 | 34 |
ENSDART00000108732 | None | 401 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 3924947)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 3609497 GRCz11 3 3391750 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTTCCTCTAGGCTGAAGGAGTGGAAAGGACCTTCACACGGAGTTGGT[T/A]ACTCTGTCCAAAGGGTTTGTTCAACTTAAGAATTTTATTCTACATTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19929
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047865 | Essential Splice Site | 1048 | 1458 | 24 | 34 |
ENSDART00000108732 | None | 401 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 3923702)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 3608252 GRCz11 3 3390505 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACAGTGATGGTTCATTCAGCACTTTTGGCTATGATCCATCCAATACATG[G/A]TGCGTGTCCTGCAGGTCAAGTCTTATTGATTTAGGTGTTGTGTAACTGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: