si:dkey-46g23.2

Ensembl ID:
ENSDARG00000077171
ZFIN ID:
ZDB-GENE-070705-476
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33077 Nonsense Mutation detected in F1 DNA During 2018
sa33076 Nonsense Mutation detected in F1 DNA During 2018
sa33075 Nonsense Available for shipment Available now
sa19929 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 11 1458 1 34
ENSDART00000108732 Nonsense 11 401 1 11
Genomic Location (Zv9):
Chromosome 3 (position 3931456)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3616006
GRCz11 3 3398259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGATGATTGCTCATCATGGCGATGATGGAGATCAGTGTTTGGAAGTG[G/A]ATCAATCTAGTCCTTTTCTTCTGTTTTGTTGATGGTGCCATGCTTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 893 1458 20 34
ENSDART00000108732   None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3925146)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3609696
GRCz11 3 3391949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAGGAACTGTAAACGTGACCATTAGTGCTGAGGCCAGTCCATCCCAG[G/T]AATTGTGTGGCGATCAGGATGTGACTGTACCATCAAGAGGACGCATTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 931 1458 21 34
ENSDART00000108732   None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3924947)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3609497
GRCz11 3 3391750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCCTCTAGGCTGAAGGAGTGGAAAGGACCTTCACACGGAGTTGGT[T/A]ACTCTGTCCAAAGGGTTTGTTCAACTTAAGAATTTTATTCTACATTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Essential Splice Site 1048 1458 24 34
ENSDART00000108732   None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3923702)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3608252
GRCz11 3 3390505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGTGATGGTTCATTCAGCACTTTTGGCTATGATCCATCCAATACATG[G/A]TGCGTGTCCTGCAGGTCAAGTCTTATTGATTTAGGTGTTGTGTAACTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link