
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ccdc153
- Ensembl ID:
- ENSDARG00000077161
- ZFIN ID:
- ZDB-GENE-080204-16
- Description:
- Coiled-coil domain-containing protein 153 [Source:UniProtKB/Swiss-Prot;Acc:A8KB59]
- Human Orthologue:
- AP002956.3
- Human Description:
- Coiled-coil domain-containing protein 153 [Source:UniProtKB/Swiss-Prot;Acc:Q494R4]
- Mouse Orthologue:
- Ccdc153
- Mouse Description:
- coiled-coil domain containing 153 Gene [Source:MGI Symbol;Acc:MGI:2448587]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10489 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10489
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110360 | Nonsense | 131 | 202 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 15 (position 22554557)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 23265744 GRCz11 15 23201009 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGATTAGCCGAGTGTCAGGTTGAATTAAAATCGGAAAGAGAGCTGCGA[G/T]AAAACACAGAAGCAGAAAAAGACGCCATCATTTCTGACCTCCAGAGCAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: