
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cbln2b
- Ensembl ID:
- ENSDARG00000077151
- ZFIN ID:
- ZDB-GENE-070615-12
- Description:
- cerebellin 2b precursor [Source:RefSeq peptide;Acc:NP_001092208]
- Human Orthologue:
- CBLN2
- Human Description:
- cerebellin 2 precursor [Source:HGNC Symbol;Acc:1544]
- Mouse Orthologue:
- Cbln2
- Mouse Description:
- cerebellin 2 precursor protein Gene [Source:MGI Symbol;Acc:MGI:88282]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14385 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14385
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112644 | Nonsense | 195 | 201 | 3 | 3 |
ENSDART00000136200 | Nonsense | 195 | 201 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 24 (position 15550304)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 15501752 GRCz11 24 15646171 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTGGAAAGAGGGAATCTAATGGGCGGATGGAAATACTCCACGTTCTCT[G/T]GATTTTTAGTCTTTCCTYTATAACTGAATCGCAAAACGCGAWGTTTTCAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Normalized brain volume: Genome-wide association analysis of susceptibility and clinical phenotype in multiple sclerosis. (View Study)
- Pulmonary arterial hypertension (without BMPR2 mutations): Genome-wide association analysis identifies a susceptibility locus for pulmonary arterial hypertension. (View Study)
- Response to TNF-alpha inhibitors in rheumatoid arthritis: Investigation of single nucleotide polymorphisms and biological pathways associated with response to TNFα inhibitors in patients with rheumatoid arthritis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: