col6a3

Ensembl ID:
ENSDARG00000077139
ZFIN ID:
ZDB-GENE-070501-8
Description:
Novel protein similar to vertebrate collagen, type VI, alpha 3 (COL6A3) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
COL6A3
Human Description:
collagen, type VI, alpha 3 [Source:HGNC Symbol;Acc:2213]
Mouse Orthologue:
Col6a3
Mouse Description:
collagen, type VI, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:88461]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30917 Nonsense Mutation detected in F1 DNA During 2018
sa45357 Nonsense Mutation detected in F1 DNA During 2018
sa34639 Nonsense Mutation detected in F1 DNA During 2018
sa41416 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31713 Nonsense Available for shipment Available now
sa27398 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Nonsense 1161 3107 7 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754   None 2027 None 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734   None 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24971227)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24127013
GRCz11 9 23937882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCTCAGACAGCCAGGAACTCCAGAGAGTCTCCAATGAGCCTAGTTA[T/A]GCACTGTCAGTGAGAGAATTTAGTGATCTTTCCAACGTCCAACAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Nonsense 1978 3107 13 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754 Nonsense 847 2027 7 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734   None 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24964935)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24120721
GRCz11 9 23931590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTGAGGATGCAGTTCTCTTGGAATATGGCCGTGGATTCAGGTATACA[C/T]GACCACTGCGTGTCAATGTCATGGATTTGGATTATGAGCTTCTGGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Nonsense 2238 3107 26 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754 Nonsense 1106 2027 20 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734   None 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24960700)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24116486
GRCz11 9 23927355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTACATATATTAAGGGGCCAGGAGGACAGCCAGGACCTGCTGGAGAA[A/T]AGGGCAGAAGGGGAGCTGTTGGTCGTAAGGTACTGGTCATCTTAAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Essential Splice Site 2297 3107 29 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754 Essential Splice Site 1165 2027 23 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734   None 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24959850)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24115636
GRCz11 9 23926505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTATTGTAGGGTGATGAAGGTTTTCCTGGTTTTCCTGGTCCAAAG[G/A]TGAGGTTACTAATGTTGTTTGCAGCCTTAAGTAAAATGTAATGCTAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Nonsense 2597 3107 37 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754 Nonsense 1460 2027 31 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734   None 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24956924)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24112710
GRCz11 9 23923579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATTCCTCCTCGTGGAGTCCGAGACCGAAGAGATCCCACCACTGACT[T/G]AGACATCGACATGGCTTTCATACTTGATAGTTCGGAGAGCACCTGGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113176 Essential Splice Site 3095 3107 None 45
ENSDART00000135769   None 305 None 9
ENSDART00000138754 Essential Splice Site 2015 2027 None 42
ENSDART00000140346   None 429 None 4
ENSDART00000142446   None 28 None 2
ENSDART00000145734 Essential Splice Site 308 320 None 10

The following transcripts of ENSDARG00000077139 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24948452)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24104238
GRCz11 9 23915107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTTGACTGACTGGCAGAGAATACCTTTAATGCTGTTTGTCTATCAC[A/T]GCACCTGTTAAACAAGGCATCATGGCTTCAGTTAAAACATAGGAACTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link