
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A1A5U5_DANRE
- Ensembl ID:
- ENSDARG00000077129
- Description:
- Notch1a proteinPutative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A1A5U5]
- Human Orthologues:
- DLK1, DLK2, DLL1, DLL3, DLL4
- Human Descriptions:
- delta-like 1 (Drosophila) [Source:HGNC Symbol;Acc:2908]
- delta-like 1 homolog (Drosophila) [Source:HGNC Symbol;Acc:2907]
- delta-like 2 homolog (Drosophila) [Source:HGNC Symbol;Acc:21113]
- delta-like 3 (Drosophila) [Source:HGNC Symbol;Acc:2909]
- delta-like 4 (Drosophila) [Source:HGNC Symbol;Acc:2910]
- Mouse Orthologues:
- Dlk1, Dlk2, Dll1, Dll3, Dll4
- Mouse Descriptions:
- delta-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104659]
- delta-like 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:94900]
- delta-like 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2146838]
- delta-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096877]
- delta-like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859388]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32330 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32330
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050858 | Essential Splice Site | 202 | 378 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 21 (position 5033425)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 4644326 GRCz10 21 4650889 GRCz11 21 4808891 GRCz11 21 4815454 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCAGTGTTGTTGTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCA[G/T]GCTTCACAGGTCAGACGTGTGAGCATAATGTTGATGATTGTACTCAACAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
- Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)
- Type 1 diabetes: The imprinted DLK1-MEG3 gene region on chromosome 14q32.2 alters susceptibility to type 1 diabetes. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: