snrnp70

Ensembl ID:
ENSDARG00000077126
ZFIN ID:
ZDB-GENE-040825-2
Description:
U1 small nuclear ribonucleoprotein 70 kDa [Source:RefSeq peptide;Acc:NP_001003875]
Human Orthologue:
SNRNP70
Human Description:
small nuclear ribonucleoprotein 70kDa (U1) [Source:HGNC Symbol;Acc:11150]
Mouse Orthologue:
Snrnp70
Mouse Description:
small nuclear ribonucleoprotein 70 (U1) Gene [Source:MGI Symbol;Acc:MGI:98341]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8712 Nonsense Mutation detected in F1 DNA During 2018
sa976 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055279 Nonsense 182 495 8 10
ENSDART00000126773 Nonsense 182 339 8 11
ENSDART00000127330   None 162 None 8
Genomic Location (Zv9):
Chromosome 3 (position 32068399)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31799709
GRCz11 3 31931423
KASP Assay ID:
2259-3635.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCAAAAAGATYGATGGTCGTAGAGTGCTTGTTGATGTTGAAAGAGGA[C/T]GAACGGTAAAAGGATGGCGCCCCCGGCGACTTGGTAAGCATTTCTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055279 Missense 199 495 9 10
ENSDART00000126773 Nonsense 199 339 10 11
ENSDART00000127330   None 162 None 8
Genomic Location (Zv9):
Chromosome 3 (position 32068963)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31800273
GRCz11 3 31931987
KASP Assay ID:
554-0881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGAACCAAATTTYTTTTCTTCACTCTCCAGGTGGGGGTCTTGGTGGCA[C/T]AAGGCGAGGAGGCGCAGATGTCAACATCAAGCACTCTGGCAGAGACGACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link