zgc:171429

Ensembl ID:
ENSDARG00000077119
ZFIN ID:
ZDB-GENE-080204-1
Description:
carbohydrate kinase domain-containing protein [Source:RefSeq peptide;Acc:NP_001103590]
Human Orthologue:
CARKD
Human Description:
carbohydrate kinase domain containing [Source:HGNC Symbol;Acc:25576]
Mouse Orthologue:
Carkd
Mouse Description:
carbohydrate kinase domain containing Gene [Source:MGI Symbol;Acc:MGI:1913353]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34562 Nonsense Mutation detected in F1 DNA During 2018
sa1116 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111214 Nonsense 219 424 6 11
ENSDART00000130208 Nonsense 420 625 6 11
ENSDART00000132068   None 116 None 2
ENSDART00000132443   None 265 None 6
ENSDART00000134954 Nonsense 131 244 5 8
ENSDART00000139687   None 226 None 4
ENSDART00000140232 Nonsense 281 304 6 6
ENSDART00000143671   None 232 None 4
ENSDART00000147098 Nonsense 125 330 5 10
ENSDART00000147820   None 287 None 2
Genomic Location (Zv9):
Chromosome 9 (position 8966254)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8931752
GRCz11 9 8910082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTACCTGCAGAGACAGTCCCAATGCTGTGGAGGAGATTGAGAAATGGT[T/A]GCCCAGGCTTCACAGTGTGGTTGTGGGACCGGGACTGGGAAGGGAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111214 Nonsense 338 424 10 11
ENSDART00000130208 Nonsense 539 625 10 11
ENSDART00000132068   None 116 None 2
ENSDART00000132443   None 265 None 6
ENSDART00000134954   None 244 None 8
ENSDART00000139687   None 226 None 4
ENSDART00000140232   None 304 None 6
ENSDART00000143671   None 232 None 4
ENSDART00000147098 Nonsense 244 330 9 10
ENSDART00000147820   None 287 None 2
Genomic Location (Zv9):
Chromosome 9 (position 8974892)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 8940390
GRCz11 9 8918720
KASP Assay ID:
554-1018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTTTTCTAACTTGCTACTTTTTTTTTTTTTTGTCAGTTCTGACCTG[T/A]AGTCAGGAGGGCAGTGGACGGCGTTGTGGAGGACAGGGGGACCTGCTGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link