
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arhgef16
- Ensembl ID:
- ENSDARG00000077114
- ZFIN ID:
- ZDB-GENE-081104-446
- Description:
- rho guanine nucleotide exchange factor 16 [Source:RefSeq peptide;Acc:NP_001116755]
- Human Orthologue:
- ARHGEF16
- Human Description:
- Rho guanine nucleotide exchange factor (GEF) 16 [Source:HGNC Symbol;Acc:15515]
- Mouse Orthologue:
- Arhgef16
- Mouse Description:
- Rho guanine nucleotide exchange factor (GEF) 16 Gene [Source:MGI Symbol;Acc:MGI:2446219]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9734 | Nonsense | Available for shipment | Available now |
sa17621 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9734
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114811 | Nonsense | 168 | 606 | 3 | 15 |
ENSDART00000131137 | Nonsense | 186 | 662 | 3 | 14 |
ENSDART00000142979 | Nonsense | 168 | 606 | 4 | 15 |
The following transcripts of ENSDARG00000077114 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 49261180)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47114575 GRCz11 8 47105041 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACTTATACCATACATACTTCTATAATCTACTTCCAGAGCCACGGTTTTA[T/A]CAGGAAATCAAGGAACGAGGCCTTAACGTCAGCAGCTTGAGCACAGAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17621
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114811 | Essential Splice Site | 290 | 606 | 5 | 15 |
ENSDART00000131137 | Essential Splice Site | 308 | 662 | 5 | 14 |
ENSDART00000142979 | Essential Splice Site | 290 | 606 | 6 | 15 |
The following transcripts of ENSDARG00000077114 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 49271838)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 47125233 GRCz11 8 47115699 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCATCACCTGTTCTCCAACATATCCGWCATCCAGGATGTCAGCAAACGG[T/C]ACASGCATCCTCTTATGTWCTCAAAAATCTTTCTTTTTTTTTTTCCTTTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: