zgc:174680

Ensembl ID:
ENSDARG00000077110
ZFIN ID:
ZDB-GENE-080204-24
Description:
hypothetical protein LOC100136843 [Source:RefSeq peptide;Acc:NP_001108034]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38160 Nonsense Available for shipment Available now
sa44384 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112431 Nonsense 240 504 3 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3536 (position 206578)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149696.1 162241
GRCz11 KN149696.2 162241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCTGGAATTTTGGCCAGAATGGTTCAGCTTGGTTTTATAGCTCGC[A/T]GAAGTTACTCTGTCCCTGCACCATTGTCCCTAGTTCATGTGGACACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112431 Nonsense 465 504 8 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3536 (position 203872)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149696.1 164947
GRCz11 KN149696.2 164947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAGAAGATGGTGTGGTGGTTCCAGAGATCCAATGCCCTTTATCTGAA[C/T]AGAGCCTTGCTCTTCTGCAGGGATTAATTGATCCCTTGACATCATCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link