si:dkey-3p4.1

Ensembl ID:
ENSDARG00000077102
ZFIN ID:
ZDB-GENE-081103-34
Description:
Novel NACHT domanin containing protein [Source:UniProtKB/TrEMBL;Acc:B0S6L5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7252 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114300 Nonsense 889 1022 7 7
ENSDART00000132358   None 609 None 4
Genomic Location (Zv9):
Chromosome 22 (position 31049026)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 37334465
GRCz11 4 37676728
KASP Assay ID:
554-4494.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGAGAGAATCAGCYGTATCCTGATCATCCASACAGATTTGACGGTKA[T/A]TATCCTCAGGTGTTGTGCAGAGAGAGTGTGTGTGGACGCTGTTACTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link