si:dkeyp-34f6.1

Ensembl ID:
ENSDARG00000077101
ZFIN ID:
ZDB-GENE-030429-10
Description:
zinc finger and BTB domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_001122011]
Human Orthologue:
ZBTB10
Human Description:
zinc finger and BTB domain containing 10 [Source:HGNC Symbol;Acc:30953]
Mouse Orthologue:
Zbtb10
Mouse Description:
zinc finger and BTB domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2139883]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43307 Nonsense Mutation detected in F1 DNA During 2018
sa36868 Nonsense Available for shipment Available now
sa36867 Nonsense Mutation detected in F1 DNA During 2018
sa18611 Nonsense Available for shipment Available now
sa16074 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113797 Nonsense 92 580 1 4

The following transcripts of ENSDARG00000077101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 33145425)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32313232
GRCz11 19 31900545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATCGCCACCAACAACAGCGACGAGTTGGTAAAAGGCAGTCGGAATTA[C/A]AAGCGGGCCTTGCTGCTGAGACATCACCTGTCCTCGGAGCACGGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113797 Nonsense 192 580 2 4

The following transcripts of ENSDARG00000077101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 33136853)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32304660
GRCz11 19 31891973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCGCCGGGAGCCGCTACTTCAAGACCCTTTACTGTCTGACAAAGAGC[G/T]AGAGCTGTGACCAAACTACCATTACACACCTGGATGTGGCAGCCGTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113797 Nonsense 340 580 2 4

The following transcripts of ENSDARG00000077101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 33136409)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32304216
GRCz11 19 31891529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGGCTGTGCGCTGGGAAGCTCTGGTTGGGGTGGGGAGAACTCGTCC[G/T]AGTCCACAGAGACGGAGCCACAGGGACCGGGTCCGGTGTTTGTCTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113797 Nonsense 440 580 3 4

The following transcripts of ENSDARG00000077101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 33127039)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32294846
GRCz11 19 31882159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCKCCGGAAAACGCCCTCAATAAGCTGAAGTGTCCCCACTGTAACTA[C/A]ATTGCCAAGCACCGGCGAACACTAAAGAGGCACCTGATCATCCAYTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113797 Nonsense 552 580 4 4

The following transcripts of ENSDARG00000077101 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 33123874)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32291681
GRCz11 19 31878994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGGAGTTYGCCCGCGATGAAGACTTYGACGAAGCCGGAGAAGGGGAC[G/T]AGGACATGGAGGCAGAAGGGGAGGAGCCCAATGAGATTGACCAATCCCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link