
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-196g2.4
- Ensembl ID:
- ENSDARG00000077087
- ZFIN ID:
- ZDB-GENE-081104-160
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R133]
- Human Orthologues:
- PRRT3, PRRT4
- Human Descriptions:
- proline-rich transmembrane protein 3 [Source:HGNC Symbol;Acc:26591]
- proline-rich transmembrane protein 4 [Source:HGNC Symbol;Acc:37280]
- Mouse Orthologues:
- Prrt3, Prrt4
- Mouse Descriptions:
- proline-rich transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:2444810]
- proline-rich transmembrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:2141677]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21375 | Nonsense | Available for shipment | Available now |
sa41294 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21375
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109430 | Nonsense | 363 | 985 | 3 | 3 |
ENSDART00000144285 | None | 322 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48588964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46427222 GRCz11 8 46435101 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGGTTTACCGAAAGAGACCAGTCAATATCTGTGGGAACAGTTCCATCTT[T/A]GAAGTCAAACCCTGGCTTTCCTACCCGTGCCCAACCCATTGATCCCTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41294
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109430 | Nonsense | 758 | 985 | 3 | 3 |
ENSDART00000144285 | None | 322 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 8 (position 48590148)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 46428406 GRCz11 8 46436285 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGGGCTGGACAGGAGCGATCAGGAGCGGACATTAGCAAGAGCCTCATA[C/T]GAAATCGTGACCCACTCAAAGACAGCAATCACGGACGCAATCTGAAGAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: