si:dkey-24n17.10

Ensembl ID:
ENSDARG00000077086
ZFIN ID:
ZDB-GENE-091118-17
Human Orthologue:
ANKRD34B
Human Description:
ankyrin repeat domain 34B [Source:HGNC Symbol;Acc:33736]
Mouse Orthologue:
Ankrd34b
Mouse Description:
ankyrin repeat domain 34B Gene [Source:MGI Symbol;Acc:MGI:2443245]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27538 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109669 Essential Splice Site 430 477 2 3
ENSDART00000144431 Missense 484 544 1 1
Genomic Location (Zv9):
Chromosome 10 (position 3059012)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3004649
GRCz11 10 3031820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCCCCCGTTGAACCAGCACGCACCAATCCCAAACATCACTCCGAGTG[G/A]CAATCTAAGCGCCAACAACAAATCAGTTTGTGGTGCAGCAGTGGGGACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link