
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
col28a1
- Ensembl ID:
- ENSDARG00000077084
- ZFIN ID:
- ZDB-GENE-070705-84
- Description:
- Novel protein containing collagen triple helix repeat domain [Source:UniProtKB/TrEMBL;Acc:A5WUJ9]
- Human Orthologue:
- COL28A1
- Human Description:
- collagen, type XXVIII, alpha 1 [Source:HGNC Symbol;Acc:22442]
- Mouse Orthologue:
- Col28a1
- Mouse Description:
- collagen, type XXVIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2685312]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5797 | Nonsense | F2 line generated | During 2018 |
sa17603 | Nonsense | Available for shipment | Available now |
sa29212 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5797
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112808 | None | 1170 | None | 34 | |
ENSDART00000132934 | None | 312 | None | 7 | |
ENSDART00000143292 | Nonsense | 89 | 133 | 4 | 6 |
ENSDART00000144300 | None | 313 | None | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 25991040)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 25921152 GRCz11 19 25505375 - KASP Assay ID:
- 554-3577.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAGAACATGGAATGCCTGGACAAACAGGATCCAAGGTAAAAGCTTGTTA[C/A]CAGTTAACCAAWGTTGACATTACAGTTCTAGATCATCTCTGTAGGGTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17603
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112808 | 807 | 1170 | 31 | 34 | |
ENSDART00000132934 | None | 312 | None | 7 | |
ENSDART00000143292 | Nonsense | 125 | 133 | 6 | 6 |
ENSDART00000144300 | None | 313 | None | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 25991620)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 25921732 GRCz11 19 25505955 - KASP Assay ID:
- 2261-3337.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGRTGTGGTGTGAAATGCCGGACGAGTCCACTGGAGCTGGTKTTTGTTAT[C/T]GACAGCTCAGAAAGTRTGGGTCCAGATAACTATGAAGTGGTGAAGGATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29212
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112808 | Nonsense | 858 | 1170 | 31 | 34 |
ENSDART00000132934 | None | 312 | None | 7 | |
ENSDART00000143292 | None | 133 | 6 | 6 | |
ENSDART00000144300 | None | 313 | None | 14 |
- Genomic Location (Zv9):
- Chromosome 19 (position 25991771)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 25921883 GRCz11 19 25506106 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGGGTGGTGCTCTACAGTCACGTGGAGGTGGTGGTGGCCAGTCTGCAA[C/T]AGCTGTATGACCAGGCTGCTGTCAAGACTGCTGTGCGCAGGATGCCATAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: