slc38a10

Ensembl ID:
ENSDARG00000077081
ZFIN IDs:
ZDB-GENE-050309-21, ZDB-GENE-050309-21
Description:
Im:6896251 protein [Source:UniProtKB/TrEMBL;Acc:A7MC02]
Human Orthologue:
SLC38A10
Human Description:
solute carrier family 38, member 10 [Source:HGNC Symbol;Acc:28237]
Mouse Orthologue:
Slc38a10
Mouse Description:
solute carrier family 38, member 10 Gene [Source:MGI Symbol;Acc:MGI:1919305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6269 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110887 Nonsense 30 475 2 14
ENSDART00000126420 Nonsense 30 1125 1 16
Genomic Location (Zv9):
Chromosome 12 (position 36555165)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34667260
GRCz11 12 34768323
KASP Assay ID:
554-5447.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACAGCATTGTGGGTGTGAGTGTTTTGACGATGCCCTTCTGCTTCAAA[C/T]AGGTAAATAGGGGGTTWTRKGAAAGTGTGCTTTGCTKATAGCAAAATTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link