zgc:172298

Ensembl ID:
ENSDARG00000077022
ZFIN ID:
ZDB-GENE-080204-112
Description:
hypothetical protein LOC100136860 [Source:RefSeq peptide;Acc:NP_001108051]
Human Orthologue:
FAM131A
Human Description:
family with sequence similarity 131, member A [Source:HGNC Symbol;Acc:28308]
Mouse Orthologue:
Fam131a
Mouse Description:
family with sequence similarity 131, member A Gene [Source:MGI Symbol;Acc:MGI:1925658]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6830 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126718 Nonsense 9 295 1 5
Genomic Location (Zv9):
Chromosome 2 (position 16863547)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17178435
GRCz11 2 16847025
KASP Assay ID:
554-5339.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTCTCCTCAGACCCGACGCTAATGCTGTATCCATGTGCAATGCTTT[T/A]GACAGCTTTACCCCAACTAAATCTAAAGGTASGTGAGGCTTCAGTGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link