ENSDARG00000077017

Ensembl ID:
ENSDARG00000077017
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45825 Nonsense Mutation detected in F1 DNA During 2018
sa1665 Essential Splice Site Available for shipment Available now
sa7256 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106571 Nonsense 493 1003 1 3
Genomic Location (Zv9):
Chromosome 24 (position 16428210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11420435
GRCz11 3 11386978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGATCCACACTGGAGTGAAAACACACAAATGTGATCAATGCGGTAAAT[C/A]ATTTTTGGCAGCTACACGGCTAAAGACTCATCTTAGATTTCATACAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106571 Essential Splice Site 580 1003 1 3
Genomic Location (Zv9):
Chromosome 24 (position 16427947)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11420172
KASP Assay ID:
554-1612.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGAGAGAAACCTTACAAGTGTTCACACTGCGACAAGGGATTCAATCAG[T/C]TAAAAATCCTGAAAAAACATRAGGATTCACACAAGAAAACAAGTACACAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106571 Nonsense 938 1003 2 3
Genomic Location (Zv9):
Chromosome 24 (position 16413423)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11405648
GRCz11 3 11372191
KASP Assay ID:
554-4859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKGCACCAGAGGATTCACACTGGAGAGAAACCTTACAAGTGTTCACACTG[C/A]GACAAGAGATTCAGTCAGTTAGGAARTCTKAAAAAACAYGAGMGGATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link