znf280d

Ensembl ID:
ENSDARG00000077013
ZFIN ID:
ZDB-GENE-030131-2260
Description:
Wu:fc02b10 protein [Source:UniProtKB/TrEMBL;Acc:B3DLG4]
Human Orthologue:
POGZ
Human Description:
pogo transposable element with ZNF domain [Source:HGNC Symbol;Acc:18801]
Mouse Orthologue:
Pogz
Mouse Description:
pogo transposable element with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:2442117]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21074 Nonsense Available for shipment Available now
sa21075 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110906 Nonsense 155 840 3 18
Genomic Location (Zv9):
Chromosome 7 (position 54181370)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52451220
GRCz11 7 52726290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATCTCAACAGCAACACCTCCTTCATCAGCTCATTAGGGTCACAGTA[T/A]CCTCCGGGAACCACTTTTACTGTTGTGCAAGGTATAAATGTTTCTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110906 Nonsense 619 840 14 18
Genomic Location (Zv9):
Chromosome 7 (position 54199157)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52469007
GRCz11 7 52744077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTGCAATAAATGCAAGTACAGATCAAGCTGCCAGAAAGCCTTCAGA[C/T]AGCATATGATCAGGTTAGGAGAAAACATGGATGAATGAATATTTACAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link