si:dkey-70o15.2

Ensembl ID:
ENSDARG00000077009
ZFIN ID:
ZDB-GENE-090313-322
Description:
Novel protein similar to H.sapiens WDFY3, WD repeat and FYVE domain containing 3 (WDFY3) [Source:Uni
Human Orthologue:
WDFY4
Human Description:
WDFY family member 4 [Source:HGNC Symbol;Acc:29323]
Mouse Orthologue:
Wdfy4
Mouse Description:
WD repeat and FYVE domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3584510]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22333 Essential Splice Site Available for shipment Available now
sa35524 Nonsense Mutation detected in F1 DNA During 2018
sa11120 Essential Splice Site Available for shipment Available now
sa22332 Nonsense Available for shipment Available now
sa35523 Nonsense Mutation detected in F1 DNA During 2018
sa24938 Nonsense Mutation detected in F1 DNA During 2018
sa13732 Nonsense Available for shipment Available now
sa6310 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Essential Splice Site 978 3182 15 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31266708)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30912656
GRCz11 13 31043106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGAGAAAATCAGCCTTCTGTCACCTTAGAAGAGGCCAGCTGCACAA[G/A]TACAGTTCCTCCCAGTCCTCTCACACTTCCTTTTTGGATTACTGCCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 1195 3182 19 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31264199)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30910147
GRCz11 13 31040597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGCACCATCTTTGTCTGGTTATGGCCAAAGGAATCAAGAAGAGCTG[T/A]TTAGTCACTGTTTATCTGAATGCAACAGCAATTGGAACAGGAAAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Essential Splice Site 1375 3182 22 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31261888)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30907836
GRCz11 13 31038286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGCGGAACATCCCGGACRATTGGGGCAGCCCTTGTTGGTTGTTTTG[G/A]TAAAATGCAGATNNCCTCTGYTAGGGCTRCACAATATATCRTTTTAGCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 1416 3182 23 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31261225)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30907173
GRCz11 13 31037623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTTGGTGGCGATGGCTTCAGACGACAGCTCTTTATATGCCTCTATC[A/T]AAGTTCTGCTCTCAGTTTTGGAGACTAATCCTGCGATGGAGCAGGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 2304 3182 41 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287 Nonsense 83 157 2 4
Genomic Location (Zv9):
Chromosome 13 (position 31241237)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30887185
GRCz11 13 31017635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGACACCGCTGAGGGCCGCAACCGCACACGCTCCCGGATACGCAGA[A/T]AGCAACAACGGCGCTCCAAAAAGGTGGATTTTTAATGCTGCTGTAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 2306 3182 41 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394   None 674 None 17
ENSDART00000145287 Nonsense 85 157 2 4
Genomic Location (Zv9):
Chromosome 13 (position 31241231)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30887179
GRCz11 13 31017629
KASP Assay ID:
554-7500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCGCTGAGGGCCGCAACCGCACACGCTCCCGGATACGCAGAAAGCAA[C/T]AACGGCGCTCCAAAAAGGTGGATTTTTAATGCTGCTGTAGCTGTTAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 2514 3182 46 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394 Nonsense 57 674 2 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31231567)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30877515
GRCz11 13 31007965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACTTCAGTGTTCCTAGTTTTCTTCAAYAATGACCACKTCAAKGCATAT[A/T]AAAGGTGAAATGAGAGTCCTTGTGATTTAAGTGGGTAAAGAACTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112653 Nonsense 2575 3182 49 62
ENSDART00000137709   None 132 None 3
ENSDART00000139394 Nonsense 129 674 6 17
ENSDART00000145287   None 157 None 4
Genomic Location (Zv9):
Chromosome 13 (position 31224856)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30870804
GRCz11 13 31001254
KASP Assay ID:
554-5002.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCATCTAAACACACTTGCTGGACGRACCTACAAWGACTTGATGCAGTA[T/G]CCTATCTTTCCCTGGRTCATCGCTGATTATRAATCAGAGGTAAAATGAAM
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link