STXBP4

Ensembl ID:
ENSDARG00000076997
Description:
syntaxin binding protein 4 [Source:HGNC Symbol;Acc:19694]
Human Orthologue:
STXBP4
Human Description:
syntaxin binding protein 4 [Source:HGNC Symbol;Acc:19694]
Mouse Orthologue:
Stxbp4
Mouse Description:
syntaxin binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1342296]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22141 Nonsense Available for shipment Available now
sa10393 Essential Splice Site Available for shipment Available now
sa4473 Nonsense F2 line generated During 2018
sa44768 Nonsense Mutation detected in F1 DNA During 2018
sa10129 Essential Splice Site Available for shipment Available now
sa12087 Essential Splice Site Available for shipment Available now
sa42067 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Nonsense 56 749 3 22
Genomic Location (Zv9):
Chromosome 12 (position 33768973)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31966970
GRCz11 12 32081872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGTTCTCAATTTGATAGGCGTGAAGATTATTGGGGGCTACAGGGGA[C/T]AGAGCGGTGAAGAGTTCGGCATTTTCATTAAACGCATTTTGCCAGGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10393
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Essential Splice Site 276 749 9 22
Genomic Location (Zv9):
Chromosome 12 (position 33777267)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31975264
GRCz11 12 32090166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTAACACATGAAGAAGCCAAAAGCATACTTACTCGAACCAAACTCAGG[T/C]TARGATATTTTCATATGAACACAACCTTWCCATAATGACAACGTAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4473
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Nonsense 288 749 10 22
Genomic Location (Zv9):
Chromosome 12 (position 33777464)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31975461
GRCz11 12 32090363
KASP Assay ID:
554-3591.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTTGACCCCACAGACCAGACCCTACAGTAGAAATCGCATTTATCAGA[C/T]GAAGATCTTCGTCAGGCTCCAGCAGTGGACCACACAGCCCTATCTCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Nonsense 457 749 14 22
Genomic Location (Zv9):
Chromosome 12 (position 33787942)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31985939
GRCz11 12 32100841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAGATTTTGATACAGTGACAAAGGAACTTTTTAAACAACCGTCCAAGT[T/A]GGATTCAGAACAGGAAGTAGCAAGATTGACATCAGATGATCTCATTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Essential Splice Site 509 749 15 22
ENSDART00000111615 Essential Splice Site 509 749 15 22
Genomic Location (Zv9):
Chromosome 12 (position 33790088)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31988085
GRCz11 12 32102987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTRAGGAAAGAGCACATCGAGGCCTTGAGGGAGCYCAAGGGACTGCAGG[T/C]ACCATTATCACACCCCTTTTAAACACMCTGTCACATGCTGGAATGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Essential Splice Site 509 749 15 22
ENSDART00000111615 Essential Splice Site 509 749 15 22
Genomic Location (Zv9):
Chromosome 12 (position 33790088)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31988085
GRCz11 12 32102987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTRAGGAAAGAGCACATCGAGGCCTTGAGGGAGCYCAAGGGACTGCAGG[T/C]ACCATTATCACACCCCTTTTAAACACMCTGTCACATGCTGGAATGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111615 Essential Splice Site 531 749 16 22
Genomic Location (Zv9):
Chromosome 12 (position 33790309)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31988306
GRCz11 12 32103208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGAGCCTTAATCATAAGATGCTGCAGGAACTGACAAAAGTTAAACAGG[T/C]ACGCAACTCGCTCTTAGCAGCCCATTTTAACTTGTGTGTGCAGCACAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link