wu:fe11g03

Ensembl ID:
ENSDARG00000076988
ZFIN ID:
ZDB-GENE-030131-4936
Human Orthologue:
ZNF839
Human Description:
zinc finger protein 839 [Source:HGNC Symbol;Acc:20345]
Mouse Orthologue:
Zfp839
Mouse Description:
zinc finger protein 839 Gene [Source:MGI Symbol;Acc:MGI:1920055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110787 Nonsense 119 311 1 5
Genomic Location (Zv9):
Chromosome 17 (position 31691692)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31615619
GRCz11 17 31632582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCCAACACCGGTTCAAGCTGAAGACCTTTCTAAAACTAGAGATGAA[C/T]AACCTTCAGAAACTGAAGAAACAGATATTATTCATGTAAAAACMGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link