
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ABCC8 (2 of 3)
- Ensembl ID:
- ENSDARG00000076973
- Description:
- ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
- Human Orthologue:
- ABCC8
- Human Description:
- ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
- Mouse Orthologue:
- Abcc8
- Mouse Description:
- ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11238 | Nonsense | Available for shipment | Available now |
sa43184 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa9167 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa2981 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa11238
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088191 | Nonsense | 156 | 889 | 5 | 26 |
- Genomic Location (Zv9):
- Chromosome 18 (position 48933727)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 50082340 GRCz11 18 50078905 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTAYTGGACTTTRGCTTTTGTCACCAAAACCATCMAGTTTGTGAAATA[C/A]GATGATCACGGCATCRGCCTCCKGCAGCTGCGGTTCTGCATTACGGGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43184
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088191 | Essential Splice Site | 193 | 889 | 6 | 26 |
- Genomic Location (Zv9):
- Chromosome 18 (position 48929610)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 50078345 GRCz11 18 50074910 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCATCCCCTGGTCTGAGTGTTGTCTAACGGTTGTGTTTTGGTTTTTCC[A/T]GCGCTACATGTGGTTTGCGTGTCCCACTGAGGTCAAGCCTCCCGATGACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9167
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088191 | Essential Splice Site | 678 | 889 | 18 | 26 |
- Genomic Location (Zv9):
- Chromosome 18 (position 48920466)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 50067939 GRCz11 18 50064504 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCAGGAGCTGCGAGCCTCGGCCCAGCACGAGGACAACATCTGCATCAAG[G/A]TGACAGAGAAATGRTTCAACCTTNACAGTCTGTGTRAAACTAAATGTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2981
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088191 | Nonsense | 780 | 889 | 24 | 26 |
- Genomic Location (Zv9):
- Chromosome 18 (position 48916065)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 50062568 GRCz11 18 50059133 - KASP Assay ID:
- 554-3268.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAWTATTTTKTATTTATTTTAGTGTAAATGTCATGTTTAAAGCGTGTATC[C/T]AGTATTTTGTMTGTTGTGTGTTCAGGTATAAGGATGTGATYGAGGTTTGT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: