zgc:112372

Ensembl ID:
ENSDARG00000076968
ZFIN ID:
ZDB-GENE-050522-185
Description:
Protein FAM100B [Source:UniProtKB/Swiss-Prot;Acc:Q502A3]
Human Orthologue:
FAM100B
Human Description:
family with sequence similarity 100, member B [Source:HGNC Symbol;Acc:28438]
Mouse Orthologues:
Fam100b, Gm7367
Mouse Descriptions:
family with sequence similarity 100, member B Gene [Source:MGI Symbol;Acc:MGI:1914635]
predicted pseudogene 7367 Pseudogene [Source:MGI Symbol;Acc:MGI:3646404]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20163 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113683 Essential Splice Site 58 172 2 3
Genomic Location (Zv9):
Chromosome 3 (position 61303796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60613079
GRCz11 3 60692883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGCTCGTTTTTCCAGGAGGCTAACATCCCCAGTCATCACCAGATGG[T/C]AAGTGCATTGAACATGGAGAAAGAGTGGCGCATTCTGCATCCTGTCATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link