cep70

Ensembl ID:
ENSDARG00000076965
ZFIN ID:
ZDB-GENE-070705-311
Description:
centrosomal protein of 70 kDa [Source:RefSeq peptide;Acc:NP_001108048]
Human Orthologue:
CEP70
Human Description:
centrosomal protein 70kDa [Source:HGNC Symbol;Acc:29972]
Mouse Orthologue:
Cep70
Mouse Description:
centrosomal protein 70 Gene [Source:MGI Symbol;Acc:MGI:1915371]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45758 Nonsense Mutation detected in F1 DNA During 2018
sa8774 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115344 Nonsense 141 609 6 18

The following transcripts of ENSDARG00000076965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12757291)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12593221
GRCz11 22 12617998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCTTTATTATAGTGGTTGTTGATGTTTGTGCCCGCACAGAAGTGTTG[T/A]CAGTCTGTGGAGCAGAAGCTGATTCAGGAGCAGCAGCAGGCCTCTCGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115344 Essential Splice Site 566 609 16 18

The following transcripts of ENSDARG00000076965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 12746625)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12582555
GRCz11 22 12607332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCTGGACAGGAGATCTGCAGCCTTCTGGAAAGCMGCGACATTGACAG[G/A]TATGTGCGTCTSTTCATTTGAAYATCTKTWAACCTTTTCCGTTWTGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link