zgc:173837

Ensembl ID:
ENSDARG00000076949
ZFIN ID:
ZDB-GENE-080213-12
Description:
hypothetical protein LOC100000337 [Source:RefSeq peptide;Acc:NP_001104703]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17529 Nonsense Available for shipment Available now
sa41635 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112276 Nonsense 46 439 1 2
Genomic Location (Zv9):
Chromosome 10 (position 19625737)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19638083
GRCz11 10 19595517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCTTCTGCTCTTTTCACTTTRSAAGGGCTRCTCCAGGGTCAAGATT[C/A]AAGTCGGRTTGCTTTAGGATCTTCAGCCCCACATNNNGAAGTTTCTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112276 Nonsense 252 439 2 2
Genomic Location (Zv9):
Chromosome 10 (position 19627431)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19639777
GRCz11 10 19597211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCCTCAAGGTGTTACTAGTCAGTCAACAACTGTGCCAAGTTCAAAG[A/T]AGCTAATTGCCTCCATCTATGGCACTCCAACAGGATCCTCTGCTCTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link