znf451

Ensembl ID:
ENSDARG00000076939
ZFIN ID:
ZDB-GENE-081107-14
Description:
Novel protein similar to vertebrate zinc finger protein 451 (ZNF451) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
ZNF451
Human Description:
zinc finger protein 451 [Source:HGNC Symbol;Acc:21091]
Mouse Orthologue:
Zfp451
Mouse Description:
zinc finger protein 451 Gene [Source:MGI Symbol;Acc:MGI:2137896]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31900 Nonsense Available for shipment Available now
sa22195 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110828 Nonsense 556 871 9 14
ENSDART00000145867 Nonsense 556 916 10 13

The following transcripts of ENSDARG00000076939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 1287916)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1285268
GRCz11 13 1415559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCGTGGCTTTGTCGAATGTGCGAGGATTTGTTTGATTCGGAGAAGT[T/A]GGTACGAAAGCATTGCGGAGATTTGAGCAGCCATAGTTTCCAGAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110828 Nonsense 589 871 9 14
ENSDART00000145867 Nonsense 589 916 10 13

The following transcripts of ENSDARG00000076939 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 1287818)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1285170
GRCz11 13 1415461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATGCGGTCACTGTCCGCAGAAGTTCTTCAAGGACTCGACTCTACGA[C/T]GACATTGCGCTAACGAGCATAACGGTGATGTAGCGTTGCGCTACTTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link