
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000076924
- Ensembl ID:
- ENSDARG00000076924
- Mouse Orthologue:
- Als2
- Mouse Description:
- amyotrophic lateral sclerosis 2 (juvenile) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1921268]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15114 | Nonsense | Available for shipment | Available now |
sa33807 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15705 | Essential Splice Site | Available for shipment | Available now |
sa33806 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12310 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15114
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108524 | Nonsense | 87 | 1658 | 3 | 37 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7927698)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9563367 GRCz11 6 9798906 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAACCAAAYATCATCAGCAGAGCCCATTTTGGAGGCAGTGCTGAGCGAA[C/T]AGCGTGTTGTTTTTGTGGCTGCTGGCTCCGCSCACAGCGGAGTYGTGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33807
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108524 | Nonsense | 531 | 1658 | 8 | 37 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7916871)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9574194 GRCz11 6 9809733 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACTGATGCCCACCTGCCTTCCTTACAGACGGAAGTGTGGAGCTGGGGA[C/T]AAGGCCAGGATGGACAACTTGGACATGGAGACCTCCTTCCCAGGTCAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15705
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108524 | Essential Splice Site | 604 | 1658 | 11 | 37 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7908884)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9582181 GRCz11 6 9817720 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAGATTCCTGACTGTTTTGCTTTTTGTWTSTCCTCTTTTGTCTTTGCGC[A/T]GCTGTCAGATGGGATTCRTGTGTGGGATATTGGGGCAGGTCWGCAGCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33806
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108524 | Nonsense | 688 | 1658 | 12 | 37 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7907154)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9583911 GRCz11 6 9819450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTAAGCAGTGTGTATGCAGGTGGACGGACGTGTGCAGCGCTGACGGATTG[T/A]AATGTCATGGGTTTTATTGCTAGTCTGCATGAGCTGGCGGCTGCAGAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12310
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108524 | Essential Splice Site | 1467 | 1658 | 31 | 37 |
- Genomic Location (Zv9):
- Chromosome 6 (position 7879804)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 9611243 GRCz11 6 9846782 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGRTCGGCACAGAYGCTGATGGAAAGCTGCTGGAGTCTCCTAAACCTGGG[T/A]ATGGAAAATAGTATTAAAGGACTCTAAGGGTGGTCTATGCAACWGCAGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: