ZNF335

Ensembl ID:
ENSDARG00000076920
Description:
zinc finger protein 335 [Source:HGNC Symbol;Acc:15807]
Human Orthologue:
ZNF335
Human Description:
zinc finger protein 335 [Source:HGNC Symbol;Acc:15807]
Mouse Orthologue:
Zfp335
Mouse Description:
zinc finger protein 335 Gene [Source:MGI Symbol;Acc:MGI:2682313]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14003 Nonsense Available for shipment Available now
sa34400 Nonsense Mutation detected in F1 DNA During 2018
sa10609 Nonsense Available for shipment Available now
sa10622 Nonsense Available for shipment Available now
sa10510 Nonsense Available for shipment Available now
sa21289 Essential Splice Site Available for shipment Available now
sa27201 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 337 1348 7 33
Genomic Location (Zv9):
Chromosome 8 (position 25160931)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24286749
GRCz11 8 24307988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTYCTATATTTGAATGCATTTTAATTGTACACACAGGTGACAGTGATTA[T/G]AAACCAGCTGATGAGGAGGCCAGATCCAGACTGGCTGTCAGTCACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 641 1348 14 33
Genomic Location (Zv9):
Chromosome 8 (position 25166205)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24292023
GRCz11 8 24313262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTTCAAGAAGCGATACACCTTCAAAATGCATCTTCTCACACACATA[C/T]AAAACTGTGGCAACAGCCTGTAAGTAAGATGTCTGGACAAGTGTATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
Genomic Location (Zv9):
Chromosome 8 (position 25168215)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24294033
GRCz11 8 24315272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTTTTTTTACCTAAAGGTAACAGTGGACCCTCTTACTCTC[C/T]AAACCATGGAGTCYATAGGGAACACATCTGTATCCCAAGATGCACTGRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
Genomic Location (Zv9):
Chromosome 8 (position 25168215)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24294033
GRCz11 8 24315272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTTTTTTTACCTAAAGGTAACAGTGGACCCTCTTACTCTC[C/T]AAACCATGGAGTCYATAGGGAACACATCTGTATCCCAAGATGCACTGRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
ENSDART00000112046 Nonsense 782 1348 17 33
Genomic Location (Zv9):
Chromosome 8 (position 25168215)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24294033
GRCz11 8 24315272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTTTTTTTTTTTACCTAAAGGTAACAGTGGACCCTCTTACTCTC[C/T]AAACCATGGAGTCYATAGGGAACACATCTGTATCCCAAGATGCACTGRGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Essential Splice Site 879 1348 19 33
Genomic Location (Zv9):
Chromosome 8 (position 25169317)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24295135
GRCz11 8 24316374
KASP Assay ID:
2260-0579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCAAAAGATTGTAACCTTCCATGTGTCGGAGAACGGGGACACTTTGG[T/A]GCAGGAGGCGTTTGAGACTGCAACAGGGGCTGTGGAGCAAGAGGAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112046 Nonsense 1151 1348 27 33
Genomic Location (Zv9):
Chromosome 8 (position 25171894)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24297712
GRCz11 8 24318951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTCACACTCAGGAGCCGTCTCCCCGTAAAGCTCGCTCCGTCCCCTCA[C/T]AGCAGACCATCATCATCAACAGCGATGAAGAAGCTTTAGCCACACTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link