SLC2A13 (2 of 3)

Ensembl ID:
ENSDARG00000076899
Description:
solute carrier family 2 (facilitated glucose transporter), member 13 [Source:HGNC Symbol;Acc:15956]
Human Orthologue:
SLC2A13
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 13 [Source:HGNC Symbol;Acc:15956]
Mouse Orthologue:
Slc2a13
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 13 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111377 Nonsense 36 601 1 12
Genomic Location (Zv9):
Chromosome 25 (position 36754312)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35161928
GRCz11 25 35666867
KASP Assay ID:
554-5576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCAAAGCGTGACCATGAACTCCAGCCGGGCCCTCCGTGTTTCGTCTA[C/A]ACGCTGGCCTTCTTCTCGGCTCTGGGAGGATTTCTGTTCGGCTATGACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link