
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-188g12.1
- Ensembl ID:
- ENSDARG00000076896
- ZFIN ID:
- ZDB-GENE-070705-332
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0E4]
- Human Orthologue:
- C10orf67
- Human Description:
- chromosome 10 open reading frame 67 [Source:HGNC Symbol;Acc:28716]
- Mouse Orthologue:
- 4921504E06Rik
- Mouse Description:
- RIKEN cDNA 4921504E06 gene Gene [Source:MGI Symbol;Acc:MGI:1918087]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19783 | Nonsense | Available for shipment | Available now |
sa32935 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19783
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110595 | Nonsense | 22 | 431 | 1 | 14 |
ENSDART00000142057 | Nonsense | 51 | 300 | 1 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 29476648)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 29778283 GRCz11 2 29761816 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAGAGGATAAACAGCATTGCGGATGAAGCCGAGGATGCGCTGATTTCA[C/T]AAGAGATTGAGGAAATACATCGGTAAGACGTTTTGTTGTTGTTGCTTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32935
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110595 | Essential Splice Site | 340 | 431 | 12 | 14 |
ENSDART00000142057 | None | 300 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 29447742)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 29749377 GRCz11 2 29732910 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTACATGTGTGTTTCACTTCTTCATTCTAATTGTTTCTTTATTTTATC[A/G]GGCTCAATAAGCAGTTGTGCATGTCCAATCAGGTGTGGGAGAAGAAATTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease and sarcoidosis (combined): Genome-wide association analysis in sarcoidosis and Crohn's disease unravels a common susceptibility locus on 10p12.2. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: