zgc:171967

Ensembl ID:
ENSDARG00000076888
ZFIN ID:
ZDB-GENE-070928-36
Description:
hypothetical protein LOC100126019 [Source:RefSeq peptide;Acc:NP_001099169]
Human Orthologue:
GANAB
Human Description:
glucosidase, alpha; neutral AB [Source:HGNC Symbol;Acc:4138]
Mouse Orthologue:
Ganab
Mouse Description:
alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5814 Nonsense F2 line generated During 2018
sa33775 Nonsense Mutation detected in F1 DNA During 2018
sa1206 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa5814
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109761 Nonsense 485 962 13 28
Genomic Location (Zv9):
Chromosome 5 (position 72014929)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68382576
GRCz11 5 69154945
KASP Assay ID:
554-3514.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTTTTTTNNNAGATATTGATTGATTTTAAGAGTGTCAGGTCTAAAA[C/T]AAGTGTCAGTTAWTGAGATGAGAGAGTGTGTTTTCTACAGGTGGTTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109761 Nonsense 660 962 20 28
Genomic Location (Zv9):
Chromosome 5 (position 72007907)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68377711
GRCz11 5 69148368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTTTCCGTGCACACGCTCACATAGACACACCGCGCAGGGAGCCCTG[G/A]CTGTTCGGCCCAGAAAACACTGCCCTCATCCGGGAGGCGGTGCGCCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1206
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109761 Nonsense 706 962 21 28
Genomic Location (Zv9):
Chromosome 5 (position 72007392)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68377200
GRCz11 5 69147857
KASP Assay ID:
554-1115.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAACAGTSTTAATTAAACTCTTTTCTTAGACCTCTGTGGGTAGAATA[T/A]CCTGCCGAGGTCAYCACTTTCTCAATTGAGGATGAGTACTTGATTGGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link