zgc:171220

Ensembl ID:
ENSDARG00000076885
ZFIN ID:
ZDB-GENE-071004-11
Description:
hypothetical protein LOC100126101 [Source:RefSeq peptide;Acc:NP_001103300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041282 Nonsense 324 517 3 3
ENSDART00000111236 Nonsense 324 517 4 4
Genomic Location (Zv9):
Chromosome 21 (position 2718960)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 2153775
GRCz11 21 2179599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTGATCGCTCAYGCTGGAGTGAAGTCGTTCAGCTGTGATCAGTGCGAT[A/T]AATCRTTTATCCGTGCATCATACTTAAACCGACACCTTAAAGTTCACGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link