wu:fl04e06

Ensembl ID:
ENSDARG00000076867
ZFIN ID:
ZDB-GENE-030619-16
Human Orthologue:
MKL2
Human Description:
MKL/myocardin-like 2 [Source:HGNC Symbol;Acc:29819]
Mouse Orthologue:
Mkl2
Mouse Description:
MKL/myocardin-like 2 Gene [Source:MGI Symbol;Acc:MGI:3050795]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18765 Nonsense Mutation detected in F1 DNA During 2018
sa10413 Nonsense Available for shipment Available now
sa10883 Essential Splice Site Available for shipment Available now
sa10111 Essential Splice Site Available for shipment Available now
sa20120 Essential Splice Site Available for shipment Available now
sa44573 Nonsense Mutation detected in F1 DNA During 2018
sa17904 Essential Splice Site Available for shipment Available now
sa9339 Nonsense Mutation detected in F1 DNA During 2018
sa18766 Nonsense Mutation detected in F1 DNA During 2018
sa15353 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 50 926 1 15
ENSDART00000113531 Nonsense 50 926 1 15
Genomic Location (Zv9):
Chromosome 3 (position 46342679)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48352232
GRCz11 3 46304566
KASP Assay ID:
2259-4007.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACTGTCTCTTCAGCCCACTCAAAGCCTTCCACCCATTAAAGAGCGC[A/T]AGAACGGTGAGTGAGACCATTCGGTCAGACCCCTCAGGCCATAACTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 50 926 1 15
ENSDART00000113531 Nonsense 50 926 1 15
Genomic Location (Zv9):
Chromosome 3 (position 46342679)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48352232
GRCz11 3 46304566
KASP Assay ID:
2259-4007.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAYTGTCTCTTCAGCCCACTCAAAGCCTTCCACCCATTAAAGAGCGC[A/T]AGAACGGTGAGTGAGACCATTCGGTCAGACCCCTYAGGCCATAACTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10883
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Essential Splice Site 118 926 4 15
Genomic Location (Zv9):
Chromosome 3 (position 46373042)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48382595
GRCz11 3 46334929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAGCAGACCTGACCGTGCTGAACTTGTTCGCATGCACATTTTACAAGG[T/C]ACGTACCTCACCGAACAGATGTGCTAAAAAAACACCAGTCTTATAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Essential Splice Site 165 926 5 15
Genomic Location (Zv9):
Chromosome 3 (position 46373306)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48382859
GRCz11 3 46335193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGACCAATGGAGCTGGTGGAGAAGAACATCCTGCCTGTTGACATTGG[T/C]AAAAACGAGGGTTATTTACCTGCATAATAAGGAAGACATACCAAAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Essential Splice Site 255 926 7 15
Genomic Location (Zv9):
Chromosome 3 (position 46376495)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48386048
GRCz11 3 46338382
KASP Assay ID:
2259-4010.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGTCATTGCTGCTGTTCCCACAAGACCCGGACCCACCCTGGTGAAGG[T/C]AAACCATATGTCTCTAAACCACAGTGATGTCATTTCCTGTCAGTGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 372 926 9 15
Genomic Location (Zv9):
Chromosome 3 (position 46387946)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48397499
GRCz11 3 46349833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAATCTTCCTGCTCCCATTGTGGTGTCTCTGCCCAGTGTGGCTCCAT[C/A]ACGTCCCAACAACGCTCGTAAAAGCGGGTCTCTTCCCTCCTGCCTAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Essential Splice Site 624 926 10 15
Genomic Location (Zv9):
Chromosome 3 (position 46392178)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48401731
GRCz11 3 46354065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAATCCTGCTTCCCATCARCCTGCCCAGCAACCCCATGAGYACACAG[G/A]TGATATTTCACTTCTGTTTATGGTTAGGAAAATGTATACGCTTATAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 748 926 13 15
ENSDART00000113531 Nonsense 748 926 13 15
Genomic Location (Zv9):
Chromosome 3 (position 46399680)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48409233
GRCz11 3 46361567
KASP Assay ID:
2259-4012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCGAAGAGCAAAGACCCMCCYGGCTACGAGGAGGCCGTCAAACAAACC[A/T]GAGGYCTGCAAGCCMCAATGCAGGTAATTTAAAGCTATKCTCAAGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 748 926 13 15
ENSDART00000113531 Nonsense 748 926 13 15
Genomic Location (Zv9):
Chromosome 3 (position 46399680)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48409233
GRCz11 3 46361567
KASP Assay ID:
2259-4012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGAAGAGCAAAGACCCCCCCGGCTACGAGGAGGCCGTCAAACAAACC[A/T]GAGGTCTGCAAGCCACAATGCAGGTAATTTAAAGCTATTCTCAAGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113531 Nonsense 863 926 15 15
Genomic Location (Zv9):
Chromosome 3 (position 46400997)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48410550
GRCz11 3 46362884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCMGAACSCTGAGACTGATGGAGGAGCTTAAAAAYCAGCTTTTGGAG[C/T]GACYACACTCTCCGATGGACACCTCAGATCTGACYTTCACAGATGCGCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link