zgc:112492

Ensembl ID:
ENSDARG00000076848
ZFIN ID:
ZDB-GENE-050417-143
Description:
galectin 3 binding protein [Source:RefSeq peptide;Acc:NP_001017658]
Human Orthologue:
LGALS3BP
Human Description:
lectin, galactoside-binding, soluble, 3 binding protein [Source:HGNC Symbol;Acc:6564]
Mouse Orthologue:
Lgals3bp
Mouse Description:
lectin, galactoside-binding, soluble, 3 binding protein Gene [Source:MGI Symbol;Acc:MGI:99554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16641 Nonsense Available for shipment Available now
sa31362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113309 Nonsense 245 561 5 5
Genomic Location (Zv9):
Chromosome 3 (position 58533445)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57649033
GRCz11 3 57719557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTATCCACAACAWCMGCTCAGTGTCTCCATCAGCTGGYGTTCATCTTT[G/T]GAGTGMAGAAGCTCATGGAGGATGTTGGCAGGGTCTTMAYTGCACTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113309 Nonsense 518 561 5 5
Genomic Location (Zv9):
Chromosome 3 (position 58532626)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57648214
GRCz11 3 57718738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCAGCACCATTCGCTACAACAGCAGGTTGGTTCTTACCTGTAAAAAT[C/T]AGAATAATGTCTTCCATGTGCAAGAATTTAAAAACGACATGGCAGTGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link