
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bx248082.1
- Ensembl ID:
- ENSDARG00000076829
- ZFIN ID:
- ZDB-GENE-100920-6
- Human Orthologue:
- ANKIB1
- Human Description:
- ankyrin repeat and IBR domain containing 1 [Source:HGNC Symbol;Acc:22215]
- Mouse Orthologue:
- Ankib1
- Mouse Description:
- ankyrin repeat and IBR domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918047]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2840 | Nonsense | F2 line generated | During 2018 |
sa6417 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa11390 | Nonsense | Available for shipment | Available now |
sa22790 | Nonsense | Available for shipment | Available now |
sa39085 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22789 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2840
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Nonsense | 337 | 1074 | 6 | 19 |
ENSDART00000131227 | Nonsense | 337 | 1074 | 7 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18135258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16176495 GRCz11 16 16084472 - KASP Assay ID:
- 554-2580.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATATTCACACTCAAGTTGCTGTATTTTTCCCTTTTCAGTGCGGTATTTG[T/A]ATGTGCGCTGCTTCCATGTTTGAAGAGCCTGTTGAWATTCCTTGTGGTCA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa6417
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Essential Splice Site | 363 | 1074 | 6 | 19 |
ENSDART00000131227 | Essential Splice Site | 363 | 1074 | 7 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18135179)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16176416 GRCz11 16 16084393 - KASP Assay ID:
- 554-4786.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTTGAWATTCCTTGTGGTCATGAGTTCTGCAGGGGATGCTGGGAAAGG[T/A]GAGCTTTTATTTCTTTTTTTTTATTCAGTATTTTAGTCACACTGWGAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11390
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Nonsense | 537 | 1074 | 10 | 19 |
ENSDART00000131227 | Nonsense | 537 | 1074 | 11 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18129495)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16170732 GRCz11 16 16078709 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGCCAACTGCAAATCTCCCATTCAGAAGAATGAGGGATGTAACCACATG[C/T]AATGTGCCAAGGTTATTTGCGTAATAACAATAATAGATCTATTTATAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22790
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Nonsense | 568 | 1074 | 11 | 19 |
ENSDART00000131227 | Nonsense | 568 | 1074 | 12 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18126242)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16167479 GRCz11 16 16075456 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAGTGGAAAAAACACAGTTCCTCTACTGGAGGGTACTACCGCTGCACA[C/T]GATATGAGGTCATTCAGCAAGTGGAGGAGCAGTCTAAAGAGATGACTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39085
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Nonsense | 610 | 1074 | 12 | 19 |
ENSDART00000131227 | Nonsense | 610 | 1074 | 13 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18125802)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16167039 GRCz11 16 16075016 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAGGAATTAGATCGCTTCATGCATTATTACACACGTTTTAAGAACCAC[G/T]AACACAGTTACCAGGTAAAAAAAAATCATTAATAATTCTAACTTGTTCTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22789
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112288 | Essential Splice Site | 762 | 1074 | 16 | 19 |
ENSDART00000131227 | Essential Splice Site | 762 | 1074 | 17 | 20 |
- Genomic Location (Zv9):
- Chromosome 16 (position 18102875)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 16144112 GRCz11 16 16052089 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTGGTGGAACATGGGACTGGGAGTATTTGGGTTTCGCCTCTCCTGAG[G/A]TAACATTTTTTAAGCCTGTTTTACAAACTTTGTGTTATTTGTGTCTTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: