MYOM1 (1 of 2)
- Ensembl ID:
- ENSDARG00000076821
- Description:
- myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613]
- Human Orthologue:
- MYOM1
- Human Description:
- myomesin 1, 185kDa [Source:HGNC Symbol;Acc:7613]
- Mouse Orthologue:
- Myom1
- Mouse Description:
- myomesin 1 Gene [Source:MGI Symbol;Acc:MGI:1341430]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa15474 |
Nonsense |
Available for shipment |
Available now |
sa34248 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa34247 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa34246 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa11567 |
Nonsense |
Available for shipment |
Available now |
sa21150 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa15474
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Nonsense |
675 |
1656 |
20 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74389198)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71534588 |
GRCz11 |
7 |
71726380 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GCACAGACAGCTGGCAGCGAGTGAACACTGAAATCCCAGTGAAATCTCCA[C/T]GMTTTGCTCTCTTTGATCYGGCCGAGGGCAAATCTTACCRCTTCAGAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34248
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Essential Splice Site |
1214 |
1656 |
29 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74375038)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71520428 |
GRCz11 |
7 |
71712220 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGTGACACACACTGATGGAGCGTCTGCCAGCTACACGTTCTCTGAAGAAG[G/A]TCGGATTATCTGTTTTCTGCTTTTTTGTTTTTGTATTTATAAGTGTGCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34247
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Essential Splice Site |
1276 |
1656 |
32 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74370767)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71516157 |
GRCz11 |
7 |
71707949 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAAGGTAATAATAATACATTTTAAACTAAACTACTCCGGTGTGTTGTA[G/T]AAATACAAGATGAACTTTGACAAAAACACTGGCATCATTGAGATGTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34246
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Nonsense |
1339 |
1656 |
33 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74370485)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71515875 |
GRCz11 |
7 |
71707667 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGTGTTTAAGCAGTTGCAGAAGGAATCAGAGTTTCAGAGGAAAGAATG[G/A]CATAGAAAGCAAGGTATGAGTATAGTGTATGCACTAAAATATTATGTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11567
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Nonsense |
1378 |
1656 |
35 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74369090)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71514480 |
GRCz11 |
7 |
71706272 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAATCTGKGCTGTAGGTTGGKAACATGAAGAAAGACTCGACGGCRTTGTG[G/A]TATAAAGATGGACGGGAGGTGAAGGTCGACGAAAAACTGGATTTCTCTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21150
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000087099 |
Nonsense |
1379 |
1656 |
35 |
43 |
- Genomic Location (Zv9):
- Chromosome 7 (position 74369087)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
71514477 |
GRCz11 |
7 |
71706269 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTGCTGTAGGTTGGTAACATGAAGAAAGACTCGACGGCGTTGTGGTA[T/G]AAAGATGGACGGGAGGTGAAGGTCGACGAAAAACTGGATTTCTCTGAAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: