
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000076809
- Ensembl ID:
- ENSDARG00000076809
- Human Orthologues:
- SAMD9, SAMD9L
- Human Descriptions:
- sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
- sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
- Mouse Orthologue:
- Samd9l
- Mouse Description:
- sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15156 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15156
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111900 | Nonsense | 966 | 1005 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 2 (position 45387559)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGTGGTACTRTTGAGCAAGGAGAGGTCTTCACAGAGTATGGAAACCTA[A/T]AGATCCCATTGCGTCCTGCACTTTATAGTGAAGTGAGAAGTGGCCACAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: