zgc:113265

Ensembl ID:
ENSDARG00000076807
ZFIN ID:
ZDB-GENE-050327-21
Description:
Zgc:113265 [Source:UniProtKB/TrEMBL;Acc:Q58EA9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20162 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102030 Nonsense 188 215 4 5
Genomic Location (Zv9):
Chromosome 3 (position 60461760)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59764219
GRCz11 3 60055320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTAAGCTTCATCTCAGAGTTCATACAACGGAGAAACCGTATTCGTG[T/A]TCTGTGTGTGGAAGGAGTTTCACATGGCGGACAAATTTAAATCGACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link