zgc:158262

Ensembl ID:
ENSDARG00000076805
ZFIN ID:
ZDB-GENE-070410-6
Description:
Leukocyte receptor cluster member 8 homolog [Source:UniProtKB/Swiss-Prot;Acc:A4QNR8]
Human Orthologue:
LENG8
Human Description:
leukocyte receptor cluster (LRC) member 8 [Source:HGNC Symbol;Acc:15500]
Mouse Orthologue:
Leng8
Mouse Description:
leukocyte receptor cluster (LRC) member 8 Gene [Source:MGI Symbol;Acc:MGI:2142195]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42672 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1304 Nonsense Available for shipment Available now
sa19133 Nonsense Mutation detected in F1 DNA During 2018
sa10160 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Essential Splice Site 14 839 1 15
Genomic Location (Zv9):
Chromosome 16 (position 14015906)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12374997
GRCz11 16 12265899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCAAAATGGCGGCGAATGCGGCTCAACAAGCCCCGACACAAAACTGG[T/A]AAGGCGTTTTTATATCTCATTAATGACATCTTCACGTTTCTAACGAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 85 839 3 15
Genomic Location (Zv9):
Chromosome 16 (position 14014948)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12374039
GRCz11 16 12264941
KASP Assay ID:
554-1219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTCCTCTGCAATGCAGCAGCAGCAGTATTATCAGCAGTGGTATCAA[C/T]AGAACCAACAGCAGTATGCTGGTTACCCTTATCCTTATAACTACTACTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 641 839 11 15
ENSDART00000113345 Nonsense 641 839 11 15
Genomic Location (Zv9):
Chromosome 16 (position 14011202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12370293
GRCz11 16 12261195
KASP Assay ID:
2260-9323.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAAAGGCTCATTGGAAAAGCAATCAGGACTATGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTGAGTGATGACTTTTAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113345 Nonsense 641 839 11 15
ENSDART00000113345 Nonsense 641 839 11 15
Genomic Location (Zv9):
Chromosome 16 (position 14011202)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12370293
GRCz11 16 12261195
KASP Assay ID:
2260-9323.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTAAAGGCTCATTGGAAAAGCAATCAGGACTAYGTCTACGCATGTGAA[C/T]AAATGAAATCCATAAGACAGGATCTAACTGTRAGTGATGACTTTTAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link