tnfrsf18

Ensembl ID:
ENSDARG00000076800
ZFIN ID:
ZDB-GENE-101104-7
Description:
tumor necrosis factor receptor superfamily, member 18 [Source:RefSeq peptide;Acc:NP_001106996]
Human Orthologue:
TNFRSF18
Human Description:
tumor necrosis factor receptor superfamily, member 18 [Source:HGNC Symbol;Acc:11914]
Mouse Orthologue:
Tnfrsf18
Mouse Description:
tumor necrosis factor receptor superfamily, member 18 Gene [Source:MGI Symbol;Acc:MGI:894675]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33941 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130666 Essential Splice Site 141 261 4 6
Genomic Location (Zv9):
Chromosome 6 (position 42911886)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42982940
GRCz11 6 42980476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACTTTAAAATAATAATGAGATCAGTTAACGAGTAATTTTTTTGTATT[A/T]GGTGTGATGGTGTTGGTGAGTTCTTCCCAGGAAACCAGACCCACAATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link