STAG3L4

Ensembl ID:
ENSDARG00000076794
Description:
stromal antigen 3-like 4 [Source:HGNC Symbol;Acc:33887]
Human Orthologues:
STAG3, STAG3L1, STAG3L2, STAG3L3, STAG3L4
Human Descriptions:
stromal antigen 3 [Source:HGNC Symbol;Acc:11356]
stromal antigen 3-like 1 [Source:HGNC Symbol;Acc:33852]
stromal antigen 3-like 2 [Source:HGNC Symbol;Acc:33886]
stromal antigen 3-like 3 [Source:HGNC Symbol;Acc:33845]
stromal antigen 3-like 4 [Source:HGNC Symbol;Acc:33887]
Mouse Orthologue:
Stag3
Mouse Description:
stromal antigen 3 Gene [Source:MGI Symbol;Acc:MGI:1355311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22398 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111217 Nonsense 140 301 4 7
Genomic Location (Zv9):
Chromosome 14 (position 222812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTAGTGTGTGTGTGTGCGTGTGTGTGTGTGTGTGTGTGTGTGCGCAGT[T/A]GATGGAGCAGCAGGAGGACCTGCGCTCTCTGATGAACGGGATCTTCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link