zgc:158426

Ensembl ID:
ENSDARG00000076779
ZFIN ID:
ZDB-GENE-030131-4913
Description:
hypothetical protein LOC568603 [Source:RefSeq peptide;Acc:NP_001116483]
Human Orthologue:
FAM13B
Human Description:
family with sequence similarity 13, member B [Source:HGNC Symbol;Acc:1335]
Mouse Orthologue:
Fam13b
Mouse Description:
family with sequence similarity 13, member B Gene [Source:MGI Symbol;Acc:MGI:2447834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30676 Nonsense Mutation detected in F1 DNA During 2018
sa35690 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113376 Nonsense 165 678 5 21
ENSDART00000126894 Nonsense 165 917 3 24
Genomic Location (Zv9):
Chromosome 14 (position 25368670)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24071761
GRCz11 14 24369006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTGTGCCGCTTCCTGTCCGGTGTGGCGTCTCTACAGGAGGAGAGCT[G/A]GAGCTTAGGAGCTCTTGCTGCCGTCTTTGGGCCTGACATTTTCCAGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113376 Essential Splice Site None 678 20 21
ENSDART00000126894 Essential Splice Site 877 917 23 24
Genomic Location (Zv9):
Chromosome 14 (position 25322698)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24025789
GRCz11 14 24323034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGACCATCAGAGAGTTTGAAGATGAGTTCTACCAGCAGAACGGCAG[G/A]TAGGCTTGCCAGATTTCATATGAATGCACAGAAGGGGCAAACATACGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link