zgc:162140

Ensembl ID:
ENSDARG00000076731
ZFIN ID:
ZDB-GENE-070410-19
Description:
hypothetical protein LOC100004656 [Source:RefSeq peptide;Acc:NP_001103955]
Human Orthologue:
C2orf65
Human Description:
chromosome 2 open reading frame 65 [Source:HGNC Symbol;Acc:25183]
Mouse Orthologue:
D6Mm5e
Mouse Description:
DNA segment, Chr 6, Miriam Meisler 5, expressed Gene [Source:MGI Symbol;Acc:MGI:1315200]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14790 Nonsense Available for shipment Available now
sa21121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110837 Nonsense 310 475 6 9
ENSDART00000138286 Nonsense 69 295 2 6
Genomic Location (Zv9):
Chromosome 7 (position 65772309)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58954049
GRCz11 7 59256479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATTTCCARCCACCAAAYAAGAGTCTCRCCAATCAAAACTTCTCACCA[C/T]AGCGCTTACGAGTTGTCAAGTACAGTCACATCTCTAGTCAGGTTTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110837 Nonsense 313 475 6 9
ENSDART00000138286 Nonsense 72 295 2 6
Genomic Location (Zv9):
Chromosome 7 (position 65772300)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58954040
GRCz11 7 59256470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACCAAACAAGAGTCTCACCAATCAAAACTTCTCACCACAGCGCTTA[C/T]GAGTTGTCAAGTACAGTCACATCTCTAGTCAGGTTTTTGTTTAAGGGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link