
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:162140
- Ensembl ID:
- ENSDARG00000076731
- ZFIN ID:
- ZDB-GENE-070410-19
- Description:
- hypothetical protein LOC100004656 [Source:RefSeq peptide;Acc:NP_001103955]
- Human Orthologue:
- C2orf65
- Human Description:
- chromosome 2 open reading frame 65 [Source:HGNC Symbol;Acc:25183]
- Mouse Orthologue:
- D6Mm5e
- Mouse Description:
- DNA segment, Chr 6, Miriam Meisler 5, expressed Gene [Source:MGI Symbol;Acc:MGI:1315200]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14790 | Nonsense | Available for shipment | Available now |
sa21121 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa14790
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110837 | Nonsense | 310 | 475 | 6 | 9 |
ENSDART00000138286 | Nonsense | 69 | 295 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65772309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58954049 GRCz11 7 59256479 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGATTTCCARCCACCAAAYAAGAGTCTCRCCAATCAAAACTTCTCACCA[C/T]AGCGCTTACGAGTTGTCAAGTACAGTCACATCTCTAGTCAGGTTTTTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21121
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110837 | Nonsense | 313 | 475 | 6 | 9 |
ENSDART00000138286 | Nonsense | 72 | 295 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 65772300)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58954040 GRCz11 7 59256470 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCACCAAACAAGAGTCTCACCAATCAAAACTTCTCACCACAGCGCTTA[C/T]GAGTTGTCAAGTACAGTCACATCTCTAGTCAGGTTTTTGTTTAAGGGCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: