myo9al1

Ensembl ID:
ENSDARG00000076729
ZFIN ID:
ZDB-GENE-080424-5
Human Orthologue:
MYO9A
Human Description:
myosin IXA [Source:HGNC Symbol;Acc:7608]
Mouse Orthologue:
Myo9a
Mouse Description:
myosin IXa Gene [Source:MGI Symbol;Acc:MGI:107735]

Alleles

There are 12 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21098 Nonsense Available for shipment Available now
sa21099 Nonsense Available for shipment Available now
sa11190 Nonsense Available for shipment Available now
sa38645 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31607 Essential Splice Site Available for shipment Available now
sa12066 Essential Splice Site Available for shipment Available now
sa12095 Essential Splice Site Available for shipment Available now
sa15001 Essential Splice Site Available for shipment Available now
sa27066 Nonsense Mutation detected in F1 DNA During 2018
sa25371 Nonsense Mutation detected in F1 DNA During 2018
sa34203 Nonsense Mutation detected in F1 DNA During 2018
sa7606 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 10 2522 1 42
Genomic Location (Zv9):
Chromosome 7 (position 58153169)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56588495
GRCz11 7 56889906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGGAAACTGCTGCTCCAATATGAGTGTTCATGATGTTGGCGGTAGA[C/T]GACGCTTTGAGGACTCCGAGCTCACCCTGCGCATCTACCCGGGGATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 82 2522 1 42
Genomic Location (Zv9):
Chromosome 7 (position 58153387)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56588713
GRCz11 7 56890124
KASP Assay ID:
2259-9587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGAAGGAGTTCGGTGGGGAGGAGTGGATTCTCAACCCCACCGATTA[T/A]CCCGTCCAGCGCATGATGCTATGGCCTCGCATGGCACTGGAGAACCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 329 2522 3 42
Genomic Location (Zv9):
Chromosome 7 (position 58218441)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56653767
GRCz11 7 56955178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAGCATATGTRGAGAAATACCTGCTGGAGAAGTCCAGACTCGTCTAY[C/T]AGGAACACAATGAAAGGTAGAAGACGTTGTGCWGTTATTAACYAATACTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 368 2522 5 42
Genomic Location (Zv9):
Chromosome 7 (position 58232296)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56667622
GRCz11 7 56969033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCACAGTGTGGAATGTTGCTCTAATCCCATCTATACCTTACTTCCA[G/A]ATGACAAAGAAACCTCACAGGCCGCACTGGGGAAATTACTATGAGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 575 2522 11 42
Genomic Location (Zv9):
Chromosome 7 (position 58276798)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56712124
GRCz11 7 57013535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAACCCTATTGAATACTGATTTTTTTCAATGTGTTTGTATTTGTTTT[A/T]GGAAGAGTACAGGGCAGAAGGCATTACCTGGCATAACATTGATTACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 662 2522 12 42
Genomic Location (Zv9):
Chromosome 7 (position 58280521)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56715847
GRCz11 7 57017258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTTCATCATTAAACACTATGCAGGAAAAGTCAAATATGGTGTGAAG[G/A]TCAGTGCTGAWTACRGCTACACWCWWATGCTAMGTTCTGTGTTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12095
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 831 2522 16 42
Genomic Location (Zv9):
Chromosome 7 (position 58297802)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56733128
GRCz11 7 57034539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACTCTACSAGCAGTAAACTCCTGGAGCGAGCCCATGGCATCCTYATG[T/C]AAGAGTCTCTCTCTGATRCACACAGCTTTAGCTTTACYGTCATTGTTMAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Essential Splice Site 912 2522 19 42
Genomic Location (Zv9):
Chromosome 7 (position 58301763)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56737089
GRCz11 7 57038500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGTCACAGCCRTACTTTGTRAAGTGCATACGATCAAACKCAGAGAAG[G/A]TKTGCGAGTCTTYGTGAATATATTGTGRTTATATATCATAMAGGTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 1139 2522 23 42
Genomic Location (Zv9):
Chromosome 7 (position 58311316)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56746642
GRCz11 7 57048053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCCAGCGGGATGCCACCATCCGCCTGCAGGCTGTGGGTAGAGGCTA[T/A]CTGGCAAGACAGAGGTACAGTACACAGTTATCTTTTTTCTACAGATACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 1786 2522 28 42
Genomic Location (Zv9):
Chromosome 7 (position 58322299)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56757625
GRCz11 7 57059036
KASP Assay ID:
554-7513.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTCGAGAACGGTTGTTGTGTGGCAGCGATACTTTAGAAGGAGACTA[C/A]ACTGAAGCGACACTTCTGATGGAAGAGGGTGAGACGAGGGGAAAACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Nonsense 1848 2522 29 42
Genomic Location (Zv9):
Chromosome 7 (position 58322578)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56757904
GRCz11 7 57059315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCAGCAGCGTGGCTCTGGAGCCCGTCCAGTGGCAGAACGATGCCCTG[C/T]AGATACTCACATGCACCAGTGACTACAAGAGCATGAACGATTTTCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039810 Missense 2201 2522 38 42
Genomic Location (Zv9):
Chromosome 7 (position 58338484)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56773810
GRCz11 7 57075221
KASP Assay ID:
554-4109.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGATTGCCTTGCAGGAGGAAACAAACCGCATGTCCGCGAATGCGCTG[G/A]CTATCGTGTTYGCCCCCTGTATCCTGCGCTGCCCTGACACCATCGACCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link